Protein curvature thylakoid 1b chloroplastic

Author: qfkm

August undefined, 2024

Webb3 maj 2016 · Armbruster U, Labs M, Pribil M, Viola S, Xu W, Scharfenberg M, et al. Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architecture by inducing membrane curvature. Plant Cell. 2013; 25(7):2661–2678. pmid:23839788 . View Article PubMed/NCBI Google Scholar 44. WebbAmong chloroplast thylakoid membrane –localized proteins, to date, only Curvature thylakoid 1 (CURT1) proteins were shown to exhibit intrinsic membrane-bending …

UniProt

Webb1 okt. 2002 · Protein CURVATURE THYLAKOID 1D, chloroplastic. Gene. CURT1D. Status. UniProtKB reviewed (Swiss-Prot) Organism. Arabidopsis thaliana ... BLAST. Download. … Webbprotein CURVATURE THYLAKOID 1A, chloroplastic Cicer arietinum 28.06 0.006 2.833 metabolism tr A0A1S2Y1I5 protein PROTON GRADIENT REGULATION 5, chloroplastic Cicer arietinum 22.018 0.001 2.816 energy tr A0A1S3EIC8 eukaryotic peptide chain release factor GTP-binding subunit-like isoform X2 Cicer arietinum 7.526 0.022 2.785 energy purolan puutarha

Integrated Transcriptional and Proteomic Profiling Reveals …

WebbProtein target information for Protein CURVATURE THYLAKOID 1B, chloroplastic (thale cress). Find diseases associated with this biological target and compounds tested against it in bioassay experiments. Webb9 juli 2013 · Here, we show that the CURVATURE THYLAKOID1 (CURT1) protein family, whose members are capable of forming oligomers, can induce membrane curvature in … Webb26 jan. 2024 · Thylakoid protein composition was analyzed with CURT1A-, CURT1B-, and CURT1C-specific antibodies after western blotting. Ponceau S Red staining (P.R.) was … purola hotels

Protein curvature thylakoid 1b chloroplastic

(PDF) Integrated Transcriptional and Proteomic Profiling Reveals ...

WebbSupplementary Table S1 List of primers used in this study Sequence (5ʹ→3ʹ) Forward Reverse For RT-qPCR analysis GtCHS GTTGGGCTCACGTTTCATTT GGGTGTGCAATCCAGAAGAT GtCHI AGAGTTGTCGGATTCCGTTG GTCACCGGCAGGATTAGTGT GtF3H AAGATTGGGGGATTTTCCAG … WebbThe CURT1B protein was localized to a specific curvature domain separated from the margin domain, and specifically depleted of chlorophyll-binding protein complexes. The acetylation and phosphorylation of the CURT1B N terminus were mutually exclusive.

Did you know?

WebbPTHR33222:SF3 PROTEIN CURVATURE THYLAKOID 1C, CHLOROPLASTIC 1 hit; Pfam. View protein in Pfam; PF14159 CAAD 1 hit; MobiDB. Search ... WebbLOC100248815 protein CURVATURE THYLAKOID 1B, chloroplastic [ (wine grape)] Gene ID: 100248815, updated on 24-Aug-2024 Summary Other designations protein CURVATURE …

Webb21 mars 2024 · A proteomic analysis confirmed the regulation of AtLHT1 by AtNLA (Liao et al. 2024), however, it remains to be tested whether this regulation is due to a direct interaction between AtLHT1 and the... Webb15 okt. 2024 · Curvature Thylakoid 1 (CURT1) proteins are major contributors to the shaping of chloroplast thylakoid membranes . In Arabidopsis thaliana, they comprise a family of four thylakoid membrane-anchored proteins—named CURT1A to D—with …

WebbGroup ID Species Protein Gene Name Bitscore info_outline Inparalog Score info_outline Seed Score info_outline Description View Group; 9778: Arabidopsis thaliana: O04616: CURT1A: 207: 1.0: 1.0: Protein Curvature Thylakoid 1A, Chloroplastic WebbDate palm (Phoenix dactylifera) is one of the most widespread fruit crop species and can tolerate drastic environmental conditions that may not be suitable for other fruit species. Excess UV-B stress is one of the greatest concerns for date palm

WebbInvolved in a dynamic process of vesicle-mediated thylakoid membrane biogenesis. Required for the normal organization of vesicles into mature thylakoid stacks and …

WebbLOC101262260 protein CURVATURE THYLAKOID 1B, chloroplastic [ (tomato)] Gene ID: 101262260, updated on 26-Aug-2024. Summary Other designations. protein … purolan grilli ruokalistaWebbLOC100824106 protein CURVATURE THYLAKOID 1B, chloroplastic [ (stiff brome)] Gene ID: 100824106, updated on 5-Apr-2024. Summary Other designations. protein … purolan päiväkoti vaasaWebb14 aug. 2024 · Europe PMC is an archive of life sciences journal literature. purolan talli järvenpääWebb21 mars 2024 · The molecular weight of the identified proteins ranged from 1.74 to 609.09 kDa ( Figure S1B ), where proteins of 20–30 and 30–40 kDa were the most abundant, … purolan grilli kokemuksia purolan päiväkotiWebb1 mars 2003 · Plastid, chloroplast thylakoid membrane 1 publication ; Multi-pass membrane protein 1 publication Note: Predominantly located in the appressed regions … purolator jobs mississaugaWebbProtein Curvature Thylakoid 1A, Chloroplastic: 860: Arabidopsis thaliana: Q8LCA1: CURT1B: 64: 0.125-Protein Curvature Thylakoid 1B, Chloroplastic: 860: Leptolyngbya sp. … purolator jobs saskatoon